glamorous toolkit alpha.2
by Tudor Girba
Hi,
Glamorous Toolkit has evolved quite a bit over the past months, and we now would like to announce that we reached alpha.2 version. It runs on top of Pharo 7:
feenk.com/gt
There quite a number of new things. Some highlights are:
- We added extensive documentation for GT, Bloc and Brick. By running "GtWorld openTour” you essentially transform the image into an elaborate wiki.
- We worked on Coder, a new set of tools that are dedicated for affecting code. For example, in the picture below we see an editor on embedded examples that can be edited and run independently.
And this one shows how we can visualize and edit the result of querying.
Just a note: To make Coder work the way we want, we extended Brick with several widgets, and enhanced significantly the linear and grid layouts.
- We added the first version of xdoc in order to serialize the Playground every time you evaluate something.
As always, we are looking forward to your feedback.
Have fun,
The feenk team
--
www.feenk.com
--
www.feenk.com
"Every thing should have the right to be different."
4 years, 3 months
Roassal Mondrian
by Nicolas Anquetil
Several strange behavior in Roassal on a fresh moose 7.1 image (the
behavior with moose 6.1).
The following script tries to show classes within their packages, with
color according to their numberOfLinesOfCode:
|model v|
model := MooseModel root allModels last.
v := RTMondrian new.
v shape rectangle.
v nodes: (model allModelNamespaces)
forEach: [ :p |
v shape rectangle.
v nodes: p types.
v normalizer
normalizeColor: #numberOfLinesOfCode
using: {Color white . Color black}
min: 0
max: 1000.
v layout grid.
].
v layout grid.
v
The result is that package color changes, not class color:
Now let's add the name of the packages (same script but for the 4th line):
|model v|
model := MooseModel root allModels last.
v := RTMondrian new.
v shape rectangle withTextAbove: #mooseName.
v nodes: (model allModelNamespaces)
forEach: [ :p |
v shape rectangle.
v nodes: p types.
v normalizer
normalizeColor: #numberOfLinesOfCode
using: {Color white . Color black}
min: 0
max: 1000.
v layout grid.
].
v layout grid.
v
The result is that packages are not colored anymore but package names are :
So the question is:
What's wrong ?
How to have package with text above in black and color of inner class
depending on their numberOfLinesOfCode ?
thanks
nicolas
--
Nicolas Anquetil
RMod team -- Inria Lille
4 years, 3 months
Cannot create FAMIX models in Moose
by Andrei Chis
Hi,
The current Moose build from https://ci.inria.fr/moose/job/moose-6.1 no
longer works and there is the following error when creating a Famix model:
- "AssertionFailure: Link to opposite links should be a bijective
operation... Please check your model!"
This is caused by `FAMIX.BehaviouralReference.pointed` and
`FAMIX.BehaviouralReference.referer` that point to attributes
in FAMIXBehaviouralEntity that are not there.
They were added by Famix-CPlusPlus that is now loaded
by ConfigurationOfFamix.
Are there some commits missing that add the missing functionality to
FAMIXBehaviouralEntity?
Or should we remove for now `Famix-CPlusPlus` from ConfigurationOfFamix?
Cheers,
Andrei
4 years, 3 months
Plotting genome scale values with Roassal
by Hernán Morales Durand
Hi,
I have a couple of Roassal questions regarding how to customize the
plots of a genome metric known as GC skew, and how to scale the
visualization to cover a (bacterial) genome scale data. I have
isolated a Roassal sample code below from BioSmalltalk to show how I
did an initial GC skew graphic:
| b values ds |
values := 'GGCTGCGTTCCCCTCAGTTAGCGCCTATCCTAAGCAGATCTGTAGTTAGTACTGTCTAAGCTTGTTAGACTACTCGGAACTTGCTGATATTAACCTTACCCCCGTCGAAACGCTTATTCCGCTTTGCTACTTCAAGCCCTGTAACATCTACTGTACTGACAAGGTTGCAGTAGCAATTGGCAAGGCTGTTTGGCATCTCAGATGACAGTTACCCGTGTTGCGCTCACCCGCAGCGACTCTCGGATACGTAACGCAGAAGACGTCTTCCGCGAGATTTGGGCGCGTCTGTCCACCTTCCCAGGTTGGCATTGGCAGAAGCTCTATCCGGCTTTGTTCCTCTAGCGGCTCCGCA'
asDNASimpleSequence gcSkewInt.
values := #(0 1 2 1 1 2 1 2 2 2 1 0 -1 -2 -2 -3 -3 -2 -2 -2 -2 -1 -2
-1 -2 -3 -3 -3 -3 -4 -5 -5 -5 -5 -4 -5 -5 -4 -4 -4 -5 -5 -4 -4 -4 -3
-3 -3 -3 -2 -2 -2 -3 -3 -2 -2 -3 -3 -3 -3 -2 -3 -3 -3 -2 -2 -2 -2 -1
-1 -2 -2 -2 -3 -3 -4 -3 -2 -2 -2 -3 -3 -3 -2 -3 -3 -2 -2 -2 -2 -2 -2
-2 -2 -3 -4 -4 -4 -4 -5 -6 -7 -8 -9 -8 -8 -9 -8 -8 -8 -8 -9 -8 -9 -9
-9 -9 -9 -9 -10 -11 -10 -11 -11 -11 -11 -10 -11 -11 -11 -12 -12 -12
-13 -13 -13 -12 -13 -14 -15 -15 -14 -14 -14 -14 -15 -15 -15 -16 -16
-16 -17 -17 -16 -16 -16 -17 -17 -16 -16 -17 -17 -17 -16 -15 -15 -15
-14 -15 -15 -14 -14 -14 -13 -14 -14 -14 -14 -14 -13 -12 -13 -13 -13
-12 -11 -12 -12 -11 -11 -11 -11 -10 -9 -10 -10 -10 -11 -11 -12 -12 -11
-11 -11 -10 -10 -11 -11 -10 -10 -10 -10 -11 -12 -13 -12 -12 -11 -11
-11 -10 -11 -10 -11 -11 -12 -12 -13 -14 -15 -14 -15 -15 -14 -15 -14
-14 -15 -15 -16 -16 -17 -16 -15 -15 -15 -15 -16 -15 -15 -15 -15 -16
-15 -16 -16 -15 -15 -15 -14 -14 -15 -14 -14 -15 -15 -15 -16 -17 -16
-17 -16 -16 -15 -15 -15 -15 -15 -14 -13 -12 -13 -12 -13 -12 -12 -13
-13 -12 -12 -13 -14 -14 -15 -16 -16 -16 -17 -18 -19 -19 -18 -17 -17
-17 -16 -15 -16 -16 -16 -16 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14
-15 -15 -15 -15 -16 -17 -16 -15 -16 -16 -16 -16 -15 -15 -15 -16 -17
-17 -18 -18 -18 -17 -18 -17 -16 -17 -17 -18 -19 -18 -19 -19).
b := RTGrapher new.
b extent: 800 @ 500.
ds := RTData new
noDot;
points: values;
connectColor: Color red;
yourself.
b add: ds.
b axisY
minValue: values min;
title: 'Skew';
color: Color black;
noDecimal.
b axisX
numberOfTicks: 10;
noDecimal;
color: Color black;
title: 'Position'.
b open
1) You can see the result in the TR Morph.png attached file. In X
axis, how can set up a tick every certain step value? For example,
every 50 points. Right now this is 88, 176, 264, 353 and I would like
to be 50, 100, 150, 200, 250, 300, 350, 400.
2) I just plotted a very short DNA sequence, however if I would like
to plot GC skew for E.coli that would take hundreds of points. The
following scripts takes ages to complete or it never ends. You will
find attached the necessary files:
| grapher ds eColiGCSkew zipArchive |
" The original dataset "
"(ZnEasy get: 'http://bioinformaticsalgorithms.com/data/realdatasets/Replication/E_coli.txt')
contents asDNASimpleSequence."
"'/Users/mvs/Downloads/E_coli.txt' asFileReference size." "4639675"
" GC Skew calc using BioSmalltalk "
"eColiGCSkew := '/Users/mvs/Downloads/E_coli.txt' asFileReference
contents asDNASimpleSequence gcSkewInt."
" GC Skew already calculated in a FUEL compressed for this example "
zipArchive := ZipArchive new.
[ zipArchive
readFrom: 'ecoligcskew.zip' fullName;
extractAllTo: '.' ]
ensure: [ zipArchive close ].
eColiGCSkew := FLMaterializer materializeFromFileNamed:
'OrderedCollection_3712516797.obj'.
grapher := RTGrapher new
extent: 800 @ 500;
yourself.
ds := RTData new
noDot;
points: eColiGCSkew;
connectColor: Color red;
yourself.
grapher add: ds.
grapher axisY
minValue: eColiGCSkew min;
title: 'Skew';
color: Color black;
noDecimal.
grapher axisX
numberOfTicks: 10;
noDecimal;
color: Color black;
title: 'Position'.
grapher open
The skew_diagram_ecoli.png shows how the expected final plot.
Cheers,
Hernán
4 years, 3 months
Looking for Job Opportunities
by Vincent BLONDEAU
Dear Smalltalk community,
My current contract at Lam Research is ending soon, I am looking for job opportunities starting in January 2019.
Last year, I finished my Ph.D. in Testing and Software Quality in the Inria's Rmod team in France.
I have been working with Pharo for five years and Visual Works for one year.
I am also experienced in creating tools to improve the efficiency of the developers.
Here are my website: https://vincentblondeau.github.io/
my LinkedIn: https://www.linkedin.com/in/vincent-blondeau/
and my GitHub: https://github.com/VincentBlondeau/
You can find my resume as an attachment.
I look forward to hearing from you.
Best Regards,
Vincent Blondeau
4 years, 3 months