Fwd: [Pharo-users] [ ANN ] Pharo Days 2016
by Tudor Girba
> Begin forwarded message:
>
> From: Sven Van Caekenberghe <sven(a)stfx.eu>
> Subject: [Pharo-users] [ ANN ] Pharo Days 2016
> Date: December 9, 2015 at 9:52:09 AM EST
> To: Any question about pharo is welcome <pharo-users(a)lists.pharo.org>, Pharo Development List <pharo-dev(a)lists.pharo.org>, Pharo Business <pharo-business(a)lists.pharo.org>
> Reply-To: Any question about pharo is welcome <pharo-users(a)lists.pharo.org>
>
> Dear fellow Pharoers,
>
> Mark your calendars: on Thursday March 31 & Friday April 1 we are organising the Pharo Days 2016. This year we moved the location to Namur, Belgium, just a bit south of Brussels, at the very beautiful location of the ‘Cercle de Wallonie’ overlooking the river Meuse.
>
> We’ll update the following page moving forward.
>
> https://medium.com/concerning-pharo/pharo-days-2016-c52fe4d7caf
>
> You can ask questions on any of the Pharo mailing lists or you can email the Pharo Board.
>
> Let's make this another success, together ! We hope to see as many of you as possible.
>
>
--
www.tudorgirba.com
"We are all great at making mistakes."
2 months, 3 weeks
Plotting genome scale values with Roassal
by Hernán Morales Durand
Hi,
I have a couple of Roassal questions regarding how to customize the
plots of a genome metric known as GC skew, and how to scale the
visualization to cover a (bacterial) genome scale data. I have
isolated a Roassal sample code below from BioSmalltalk to show how I
did an initial GC skew graphic:
| b values ds |
values := 'GGCTGCGTTCCCCTCAGTTAGCGCCTATCCTAAGCAGATCTGTAGTTAGTACTGTCTAAGCTTGTTAGACTACTCGGAACTTGCTGATATTAACCTTACCCCCGTCGAAACGCTTATTCCGCTTTGCTACTTCAAGCCCTGTAACATCTACTGTACTGACAAGGTTGCAGTAGCAATTGGCAAGGCTGTTTGGCATCTCAGATGACAGTTACCCGTGTTGCGCTCACCCGCAGCGACTCTCGGATACGTAACGCAGAAGACGTCTTCCGCGAGATTTGGGCGCGTCTGTCCACCTTCCCAGGTTGGCATTGGCAGAAGCTCTATCCGGCTTTGTTCCTCTAGCGGCTCCGCA'
asDNASimpleSequence gcSkewInt.
values := #(0 1 2 1 1 2 1 2 2 2 1 0 -1 -2 -2 -3 -3 -2 -2 -2 -2 -1 -2
-1 -2 -3 -3 -3 -3 -4 -5 -5 -5 -5 -4 -5 -5 -4 -4 -4 -5 -5 -4 -4 -4 -3
-3 -3 -3 -2 -2 -2 -3 -3 -2 -2 -3 -3 -3 -3 -2 -3 -3 -3 -2 -2 -2 -2 -1
-1 -2 -2 -2 -3 -3 -4 -3 -2 -2 -2 -3 -3 -3 -2 -3 -3 -2 -2 -2 -2 -2 -2
-2 -2 -3 -4 -4 -4 -4 -5 -6 -7 -8 -9 -8 -8 -9 -8 -8 -8 -8 -9 -8 -9 -9
-9 -9 -9 -9 -10 -11 -10 -11 -11 -11 -11 -10 -11 -11 -11 -12 -12 -12
-13 -13 -13 -12 -13 -14 -15 -15 -14 -14 -14 -14 -15 -15 -15 -16 -16
-16 -17 -17 -16 -16 -16 -17 -17 -16 -16 -17 -17 -17 -16 -15 -15 -15
-14 -15 -15 -14 -14 -14 -13 -14 -14 -14 -14 -14 -13 -12 -13 -13 -13
-12 -11 -12 -12 -11 -11 -11 -11 -10 -9 -10 -10 -10 -11 -11 -12 -12 -11
-11 -11 -10 -10 -11 -11 -10 -10 -10 -10 -11 -12 -13 -12 -12 -11 -11
-11 -10 -11 -10 -11 -11 -12 -12 -13 -14 -15 -14 -15 -15 -14 -15 -14
-14 -15 -15 -16 -16 -17 -16 -15 -15 -15 -15 -16 -15 -15 -15 -15 -16
-15 -16 -16 -15 -15 -15 -14 -14 -15 -14 -14 -15 -15 -15 -16 -17 -16
-17 -16 -16 -15 -15 -15 -15 -15 -14 -13 -12 -13 -12 -13 -12 -12 -13
-13 -12 -12 -13 -14 -14 -15 -16 -16 -16 -17 -18 -19 -19 -18 -17 -17
-17 -16 -15 -16 -16 -16 -16 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14
-15 -15 -15 -15 -16 -17 -16 -15 -16 -16 -16 -16 -15 -15 -15 -16 -17
-17 -18 -18 -18 -17 -18 -17 -16 -17 -17 -18 -19 -18 -19 -19).
b := RTGrapher new.
b extent: 800 @ 500.
ds := RTData new
noDot;
points: values;
connectColor: Color red;
yourself.
b add: ds.
b axisY
minValue: values min;
title: 'Skew';
color: Color black;
noDecimal.
b axisX
numberOfTicks: 10;
noDecimal;
color: Color black;
title: 'Position'.
b open
1) You can see the result in the TR Morph.png attached file. In X
axis, how can set up a tick every certain step value? For example,
every 50 points. Right now this is 88, 176, 264, 353 and I would like
to be 50, 100, 150, 200, 250, 300, 350, 400.
2) I just plotted a very short DNA sequence, however if I would like
to plot GC skew for E.coli that would take hundreds of points. The
following scripts takes ages to complete or it never ends. You will
find attached the necessary files:
| grapher ds eColiGCSkew zipArchive |
" The original dataset "
"(ZnEasy get: 'http://bioinformaticsalgorithms.com/data/realdatasets/Replication/E_coli.txt')
contents asDNASimpleSequence."
"'/Users/mvs/Downloads/E_coli.txt' asFileReference size." "4639675"
" GC Skew calc using BioSmalltalk "
"eColiGCSkew := '/Users/mvs/Downloads/E_coli.txt' asFileReference
contents asDNASimpleSequence gcSkewInt."
" GC Skew already calculated in a FUEL compressed for this example "
zipArchive := ZipArchive new.
[ zipArchive
readFrom: 'ecoligcskew.zip' fullName;
extractAllTo: '.' ]
ensure: [ zipArchive close ].
eColiGCSkew := FLMaterializer materializeFromFileNamed:
'OrderedCollection_3712516797.obj'.
grapher := RTGrapher new
extent: 800 @ 500;
yourself.
ds := RTData new
noDot;
points: eColiGCSkew;
connectColor: Color red;
yourself.
grapher add: ds.
grapher axisY
minValue: eColiGCSkew min;
title: 'Skew';
color: Color black;
noDecimal.
grapher axisX
numberOfTicks: 10;
noDecimal;
color: Color black;
title: 'Position'.
grapher open
The skew_diagram_ecoli.png shows how the expected final plot.
Cheers,
Hernán
5 years, 1 month
Re: [Pharo-users] Pharo eye-candy: Domain-Specific Modeling and Simulation
by Nick Papoylias
Thanx Alex :)
Looking forward to the Roassal talk on Thursday !
On Fri, Sep 7, 2018 at 5:22 PM Alexandre Bergel via Pharo-users <
pharo-users(a)lists.pharo.org> wrote:
> Wow!!!!!
> You guys rock!
>
> Alexandre
> --
> _,.;:~^~:;._,.;:~^~:;._,.;:~^~:;._,.;:~^~:;._,.;:
> Alexandre Bergel http://www.bergel.eu
> ^~:;._,.;:~^~:;._,.;:~^~:;._,.;:~^~:;._,.;:~^~:;.
>
>
>
> On Sep 6, 2018, at 2:17 PM, Nick Papoylias <npapoylias(a)gmail.com> wrote:
>
> A nice example of how Pharo can be used for
> domain-specific modeling and simulation. Short
> session from one of our projects at Rochelle:
>
> https://www.youtube.com/watch?v=Z7wJNhAIaVQ
>
> Some additional info here: https://goo.gl/jS4NjB
>
> Currently investigating how to incorporate the new Bloc based
> widgets of @feenkcom into the workflow.
>
> Cheers,
>
> Nick
> _______________________________________________
> Moose-dev mailing list
> Moose-dev(a)list.inf.unibe.ch
> https://www.list.inf.unibe.ch/listinfo/moose-dev
>
>
>
5 years, 3 months
Centering edges over composites
by Hernán Morales Durand
Hi,
When connecting two composite shapes with RTEdgeBuilder, the connector
position loose its center over the connecting shapes.
It's easier to explain with two scripts:
This one looks good, the connector (RTArrowedLine) is centered:
| view shapes myElems |
view := RTView new.
myElems := 1 to: 2.
shapes := (RTSVGPath new
path: 'm 3.96875,9.2604167 h 31.75 V 25.135417 C 22.489583,23.8125
17.197917,34.395833 3.96875,27.78125 Z';
fillColor: Color red;
borderColor: Color black;
borderWidth: 1.2;
scale: 1.4) elementsOn: myElems.
view addAll: shapes.
RTEdgeBuilder new
view: view;
shape: (RTArrowedLine new
color: Color white;
yourself);
elements: shapes;
connectFrom: 1 to: 2.
RTTreeLayout new
verticalGap: 30;
horizontalGap: 30;
applyOn: shapes.
view inspect.
However when adding a label in a composite, both label and arrow looks shifted:
| view shape shapes myElems |
view := RTView new.
myElems := 1 to: 2.
shape := RTCompositeShape new
add: (RTLabel new text: 'Test');
add: (RTSVGPath new
path: 'm 3.96875,9.2604167 h 31.75 V 25.135417 C
22.489583,23.8125 17.197917,34.395833 3.96875,27.78125 Z';
fillColor: Color red;
borderColor: Color black;
borderWidth: 1.2;
scale: 1.4);
vertical;
yourself.
shapes := shape elementsOn: myElems.
view addAll: shapes.
RTEdgeBuilder new
view: view;
shape: (RTArrowedLine new
color: Color white;
yourself);
elements: shapes;
connectFrom: 1 to: 2.
RTTreeLayout new
verticalGap: 30;
horizontalGap: 30;
applyOn: shapes.
view inspect.
Any idea how to align these shapes?
Cheers,
Hernán
5 years, 3 months