- Moose-dev - INF Mailman

Final Reminder: Only 5 spots left for Camp Smalltalk! Raspberry PI kits to all who attend!

by Mariano Martinez Peck

Hello All, There are 5 slots left for Camp Smalltalk Charlotte 2019 taking place at the end of this month. Now is the time to sign up if you are thinking of attending (see bottom for registration link). Camp Smalltalk is about community engagement and collaboration. There are a number of fantastic talks already lined up such as: Developing Smalltalk solutions running directly on ios / android mobile platforms (along with tooling) Live demo of @1MB remote-debuggable smalltalk images controlling peripherals attached to a Raspberry PI (ARM) In-depth look at large scale use of CMake/CTest/CDash for use with Smalltalk systems Smalltalk dialect portability solutions for the Smalltalk community (for use with GIT) We also have a fantastic Saturday evening social dinner planned on the boardwalk near the hotel. *As a special gift to attendees*, Instantiations will be providing everyone with their own Raspberry PI Zero Wifi devices with 8GB mini-sd card and power supply. Raspbian Linux with VA Smalltalk for ARM will be pre-installed. And if that isn't enough, each attendee will be receiving an open-source license for VA Smalltalk. This event is happening *March 29th – March 31st 2019* in Charlotte, North Carolina. Event details and registration info are available at the following link: Camp Smalltalk Charlotte 2019 <https://www.eventbrite.com/e/camp-smalltalk-charlotte-2019-tickets-52380940…> Hope to see you there! [image: IMG_0912.jpg] -- Mariano https://twitter.com/MartinezPeck http://marianopeck.wordpress.com

6 years, 4 months

1
0
0 0

anything like matplotlib/gnuplot interactive graphing?

by rsykora＠disroot.org

Dear list, I am checking what Roassal can do and was wondering if I could use it for quick data analysis, e.g., to draw a simple xy-data graph from a file and play around interactively with that, with the possibility to zoom / zoom back, switch easily to logarithmic axes, etc. So far I see RTGrapher, but as far as I can tell, no usable zooming functionality exists. Is there anything better? Thanks for any comments Ruda

6 years, 4 months

5
4
0 0

using GT Releaser for handling Moose?

by Tudor Girba

Hi, Andrei wrote a post describing GT Releaser: https://medium.com/feenk/continuous-delivery-with-gt-releaser-4fc6c30e1f33 We use it for releasing reliably GT. GT is spread throughout multiple repositories and have deep dependencies, and yet we release it on every commit in a reliable fashion, while still allowing people to load small pieces independently from the overall GT. For example, people can load GT Examples, or GT Releaser independently. Another thing is that we also handle the dependencies to external projects, such as SmaCC. The same can be applied for Moose. Would you like to look into this opportunities to make Moose more modular and friendlier to outside projects? Cheers, Doru -- www.feenk.com "No matter how many recipes we know, we still value a chef."

6 years, 4 months

4
4
0 0

Playing with PPHighlighter + inspector extensions

by Julien

I am able to do that: Changing node selected on the left updates the selection interval on the right. Highlighter is generated automatically from my PPCompositeParser. One step further to get good integration of PostgreSQL source code into Pharo environment. Next step is to have a code editor for PostgreSQL source code (really close to have it). Julien --- Julien Delplanque Doctorant à l’Université de Lille http://juliendelplanque.be/phd.html <http://juliendelplanque.be/phd.html> Equipe Rmod, Inria Bâtiment B 40, Avenue Halley 59650 Villeneuve d'Ascq Numéro de téléphone: +333 59 35 86 40

6 years, 4 months

1
0
0 0

Moose web site is down

by Stéphane Ducasse

Hello doru I do not know if you know but the moose web site is down. Stef -------------------------------------------- Stéphane Ducasse http://stephane.ducasse.free.fr http://www.synectique.eu / http://www.pharo.org 03 59 35 87 52 Assistant: Julie Jonas FAX 03 59 57 78 50 TEL 03 59 35 86 16 S. Ducasse - Inria 40, avenue Halley, Parc Scientifique de la Haute Borne, Bât.A, Park Plaza Villeneuve d'Ascq 59650 France

6 years, 4 months

2
1
0 0

Camp Smalltalk Charlotte 2019 Update!

by Mariano Martinez Peck

Hello Smalltalkers, Camp Smalltalk Charlotte 2019 is looking good! At this point we are over half full. Looks like some cool demos using different Smalltalk dialects are already lining up. A google groups forum has been created for attendees so everyone can collaborate beforehand. Attendees will get an invitation for group access shortly after registering. This event is happening March 29th – March 31st 2019 in Charlotte, North Carolina. Please register for the event as spots will be limited. Event details and registration info are available at the following link: Camp Smalltalk Charlotte 2019 <https://www.google.com/url?q=https%3A%2F%2Fwww.eventbrite.com%2Fe%2Fcamp-sm…> Hope to see you there! -- Mariano https://twitter.com/MartinezPeck http://marianopeck.wordpress.com

6 years, 4 months

1
0
0 0

MSE interchange of custom properties

by Peter Uhnak

Hi, is it possible to interchange custom properties via MSE? e.g. I have added myProp to the method: ~~~~ ( (FAMIX.Class (id: 1) (name 'MyClass')) (FAMIX.Method (id: 2) (name 'myMethod') (myProp 'someValue') (parentType (ref: 1)))) ~~~ This is imported fine ~~~ s := Clipboard clipboardText asString. model := MooseModel importFromMSEStream: s readStream. model allMethods first propertyNamed: 'myProp'. "'someValue'" ~~~ However 1) I cannot see it in the Properties tab of the Moose Inspector, 2) when I export it, it is lost (instead some other properties are exported that I didn't ask for) ~~~ model asMSEString. "'( (FAMIX.Class (id: 1) (name ''MyClass'')) (FAMIX.Method (id: 2) (name ''myMethod'') (cyclomaticComplexity -1) (numberOfConditionals -1) (numberOfLinesOfCode -1) (numberOfStatements -1) (parentType (ref: 1)) (timeStamp '''')))'" ~~~ The same thing applies when I add custom Metanool annotation in the Meta edit tab... e.g. I add `an AnonymousClass[String]` with name `anotherProp` and some value, I can actually see it in the `Properties` tab (unlike the one imported), but when exported, it is also missing. Do I need to do some extra steps in order to interchange this information? Thanks, Peter

6 years, 5 months

3
4
0 0

moose model extension

by Hayatou Oumarou

Hello,How can I extend Moose metamodel to add new metrics at methods, classes and packages levels and how to compute its then show it in the navigation.thank you ------------------------------------ Hayatou Oumarou, PhD Software EngineeringUniversity of Maroua, Cameroon (+237)699470504

6 years, 5 months

2
1
0 0

[REMINDER] Camp Smalltalk 2019 in Charlotte, NC at the end of March!

by Mariano Martinez Peck

Happy New Year to All! For those that haven't heard, Instantiations is sponsoring a Camp Smalltalk on March 29th – March 31st 2019 in Charlotte, North Carolina. Please register for the event soon as spots will be limited. Event details and registration info are available at the following link: Camp Smalltalk Charlotte 2019 <https://www.eventbrite.com/e/camp-smalltalk-charlotte-2019-tickets-52380940…> Thanks to Instantiations, I will be flying down there too, so I hope I can at least see some of you :) -- Mariano https://twitter.com/MartinezPeck http://marianopeck.wordpress.com

6 years, 5 months

1
0
0 0

glamorous toolkit: v0.4.0

by Tudor Girba

Hi, Things are moving fast in the glamorous land. We now reached v0.4.0: https://gtoolkit.com There are several significant advances in this version. The first thing to note is that v0.4.0 is a reproducible version that can be loaded with: Metacello new baseline: 'GToolkit'; repository: 'github://feenkcom/gtoolkit:v0.4.0/src'; load. https://github.com/feenkcom/gtoolkit/releases/tag/v0.4.0 The version was created with Releaser the new member of GT that is able to release deeply nested projects: https://twitter.com/girba/status/1073407418460225536 The rest of the environment has seen a few key changes as well: - Documenter received support for dynamic markup edit. This is an almost magic ability that makes the markup appear when the cursor nears the markup. With this we have reached a seamless experience that supports both viewing without markup and editing on demand. https://twitter.com/feenkcom/status/1067879286143676419 - Playground uses Coder and snippets are now collapsable. https://twitter.com/feenkcom/status/1070806168459767809 - The Inspector updates when the code changes. https://twitter.com/feenkcom/status/1072581283925159936 https://twitter.com/feenkcom/status/1072107898900238337 - The Meta view from Inspector was enhanced to show the super classes and method categories, each of these act list filters. On top of that, we can also filter methods by name. https://twitter.com/feenkcom/status/1072223641583149057 A more complete list of issues we addressed is found here: https://github.com/feenkcom/gtoolkit/milestone/2?closed=1 Please do let us know what you think .. and, of course, what you feel. Have fun, The feenk team -- www.feenk.com “How do you feenk today?"

6 years, 6 months

7
30
0 0

Roassal: Adjusting to fixed canvas size

by Hernán Morales Durand

Hi guys, Using Pharo 6.1/Win here. Is there any way to adjust a RTView canvas to a fixed size, say 620 x 744 px, before the elements gets added into the view? This is what I've tried so far: 1) Empty canvas manually set to 620 x 744 px produces 1x1 image: | view | view := RTView new setCanvas: (TRCanvas new extent: 620 @ 744; yourself); yourself. (RTCanvasExporter canvas: view canvas) format: #png; fileName: 'test_empty.png'; export. 2) Non-empty canvas manually set to 620 x 744 px produces 25x15 image: | view elems | view := RTView new setCanvas: (TRCanvas new extent: 620 @ 744; yourself); yourself. elems := (RTBox new color: Color blue) elementsOn: (1 to: 5). view addAll: elems. RTGridLayout on: view elements. (RTCanvasExporter canvas: view canvas) format: #png; fileName: 'test_5elems.png'; export. 3) Idem 2) adding #scale: 10 -> 250x150px ... #scale: 24.8 -> 620 px | view elems | view := RTView new setCanvas: (TRCanvas new extent: 620 @ 744; yourself); yourself. elems := (RTBox new color: Color blue) elementsOn: (1 to: 5). view addAll: elems. RTGridLayout on: view elements. (RTCanvasExporter canvas: view canvas) format: #png; scale: 12.4; fileName: 'test_5elems_scaled.png'; export. 4) Adding #oversizedBy: to 3) finally makes the trick: | view elems | view := RTView new setCanvas: (TRCanvas new extent: 620 @ 744; yourself); yourself. elems := (RTBox new color: Color blue) elementsOn: (1 to: 5). view addAll: elems. RTGridLayout on: view elements. (RTCanvasExporter canvas: view canvas) format: #png; scale: 24.8; oversizedBy: 0 @ 15; fileName: 'test_5elems_scale2_osized.png'; export. - So setting manually canvas extent doesn't have any effect? - Any way also to set a fixed margin or padding size (distance between image element and border)? Cheers, Hernán

6 years, 6 months

1
0
0 0

New book: Pharo with Style

by Stéphane Ducasse

Hello Fellow Pharoers and Smalltalk lovers I'm happy to announce a new little book to improve the culture around Pharo. I will revise it in the future so you can feel free to send feedback and pull requests to https://github.com/SquareBracketAssociates/Booklet-PharoWithStyle Stef "The best way to predict the future is to invent" so I do it. :) -------------------------------------------- Stéphane Ducasse http://stephane.ducasse.free.fr http://www.synectique.eu / http://www.pharo.org 03 59 35 87 52 Assistant: Julie Jonas FAX 03 59 57 78 50 TEL 03 59 35 86 16 S. Ducasse - Inria 40, avenue Halley, Parc Scientifique de la Haute Borne, Bât.A, Park Plaza Villeneuve d'Ascq 59650 France

6 years, 6 months

1
0
0 0

About a separate mailing-list about GT

by Stéphane Ducasse

Hi doru Would it be possible to have a separate mailing-list for GT? Stef -------------------------------------------- Stéphane Ducasse http://stephane.ducasse.free.fr http://www.synectique.eu / http://www.pharo.org 03 59 35 87 52 Assistant: Julie Jonas FAX 03 59 57 78 50 TEL 03 59 35 86 16 S. Ducasse - Inria 40, avenue Halley, Parc Scientifique de la Haute Borne, Bât.A, Park Plaza Villeneuve d'Ascq 59650 France

6 years, 6 months

2
5
0 0

PetitParser release: v2.1.0

by Julien

Hello, This email to announce that a new minor release of PetitParser (1) has been published on GitHub (v2.1.0). Here is the change log: Summary ----------- - Each package has its tests separated in a separated package. - Cleaned baseline, made it more modular. - Created more groups to let people load the part of the project they want. - Some cleaning in `PetitParser` package. - Integrated PetitPreprocessor and PetitParserExtensions in the project as separated groups Changelog ----------- #31 Extract PPTextHighlighter into a separated package. #21 Add contribution guidelines #13 Update README with new groups #9 Fix CI configuration #19 A TODO comment in PPMemoizedParser>>#parseOn: might need to be fixed cleaning #11 Inconsistent method classification #15 Split tests in their own packages cleaning #22 PetitPreprocessor is missing some extensions #3 Use `>>>` notation for examples inside method #8 PPStream>>#column: has commented code that should be removed #7 PPCharSetPredicate and PPContextMemento need to be commented #1 Replace 'Oops' error message with a meaningful message #4 PPContext>>#on:stream: should be removed #2 Integrate PetitParserExtensions package from Smalltalkhub #5 Integrate PetitPreprocessor package from Smalltalkhub Thanks to Cyril Ferlicot for his help. Cheers, Julien --- Julien Delplanque Doctorant à l’Université de Lille http://juliendelplanque.be/phd.html Equipe Rmod, Inria Bâtiment B 40, Avenue Halley 59650 Villeneuve d'Ascq Numéro de téléphone: +333 59 35 86 40

6 years, 6 months

4
5
0 0

Help: how to follow Parameters

by Erik Stel

Through a jdt2famix parsed model of an application I'm trying to follow the usage of a (FAMIX)Parameter. How can this be done? >From a method parameter I can access its enclosing method and from there on find invocations within that method for example. The problem is that there does not seem to be a direct way to retrieve the fact that a parameter is part of a method invocation (both direct or as part of an expression). It seems I have to parse a piece of the source code (the invocation signature to be precise). This does not feel okay. Can anyone give some pointers on how to find parameter usage without resorting to parsing the source code (if such a solution exists)? (Googling didn't help so far, or I'm not using the right search parameters ;-) Example Java source code, for which I want to follow the 'x' parameter: void startPoint(String x, int y) { // Here is first 'simple' parameter usage this.doSomething(x, y); // Here parameter is part of an expression this.that.doAnother("[" + x + "]"); // Parameter is part of expression again (twice) this.doLast(x.substring(0, y) + x.substring(y + 8)); } Cheers, Erik -- Sent from: http://forum.world.st/Moose-f1310756.html

6 years, 6 months

3
5
0 0

[ANN] PetitParser (1) has been migrated to Github

by Julien

Hello, I just finished the migration of PetitParser (1) on Github: https://github.com/moosetechnology/PetitParser <https://github.com/moosetechnology/PetitParser> . I created a release v1.9.2 which mirrors latest release of Smalltalkhub. Cheers, Julien --- Julien Delplanque Doctorant à l’Université de Lille http://juliendelplanque.be/phd.html Equipe Rmod, Inria Bâtiment B 40, Avenue Halley 59650 Villeneuve d'Ascq Numéro de téléphone: +333 59 35 86 40

6 years, 7 months

2
1
0 0

Users of Phexample are trapped

by Stéphane Ducasse

We should pay attention to super vicious dependencies. For example ConfigurationOfPhexample dependent on a new version of StateSpecs. baseline21: spec <version: '2.1-baseline'> spec for: #'common' do: [ spec blessing: #'baseline'. spec repository: 'http://www.smalltalkhub.com/mc/Phexample/Phexample/main'. spec baseline: 'StateSpecs' with: [ spec repository: 'github://dionisiydk/StateSpecs:v2.4.x’]. ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ spec package: 'Phexample' ]. Since this baseline is referring to github, it means that old users of Phexample cannot load anymore their code. This is funny because they cannot load their code to be able to fix it to load in recent pharo version. So Alain cannot migrate his project because petitparser use Phexample. Stef -------------------------------------------- Stéphane Ducasse http://stephane.ducasse.free.fr http://www.synectique.eu / http://www.pharo.org 03 59 35 87 52 Assistant: Julie Jonas FAX 03 59 57 78 50 TEL 03 59 35 86 16 S. Ducasse - Inria 40, avenue Halley, Parc Scientifique de la Haute Borne, Bât.A, Park Plaza Villeneuve d'Ascq 59650 France

6 years, 7 months

3
5
0 0

Migrate PetitParser (1) on GitHub under moosetechnology organisation?

by Julien

Hello, I’d like to migrate PetitParser (1) on GitHub under moosetechnology organisation. I have a project depending on it and there are some stuff I’d like to fix on PetitParser 1 ConfigurationOf (which will become a baseline on GitHub). Is it ok to migrate it? Cheers, Julien --- Julien Delplanque Doctorant à l’Université de Lille http://juliendelplanque.be/phd.html Equipe Rmod, Inria Bâtiment B 40, Avenue Halley 59650 Villeneuve d'Ascq Numéro de téléphone: +333 59 35 86 40

6 years, 7 months

2
3
0 0

[ANN] Camp Smalltalk 2019 in Charlotte, NC

by Mariano Martinez Peck

Greetings Fellow Smalltalkers, We would like to invite you to Camp Smalltalk, March 29th – March 31st 2019 in Charlotte, North Carolina. Event details and registration info are available at the following link: Camp Smalltalk Charlotte 2019 <https://www.eventbrite.com/e/camp-smalltalk-charlotte-2019-tickets-52380940…> Hope to see you there! -- Mariano

6 years, 7 months

1
0
0 0

MetricNormaliser on edges

by Nicolas Anquetil

A question on normalizing edges in RTMondrian: I want to show the "strength" of the edges, computed according to some metric. How can I normalize for example the color of the edge to reflect this "strength" ? Or maybe, normalize the "boldness" of the edge ? nicolas -- Nicolas Anquetil RMod team -- Inria Lille

6 years, 7 months

1
1
0 0

glamorous toolkit alpha.2

by Tudor Girba

Hi, Glamorous Toolkit has evolved quite a bit over the past months, and we now would like to announce that we reached alpha.2 version. It runs on top of Pharo 7: feenk.com/gt There quite a number of new things. Some highlights are: - We added extensive documentation for GT, Bloc and Brick. By running "GtWorld openTour” you essentially transform the image into an elaborate wiki. - We worked on Coder, a new set of tools that are dedicated for affecting code. For example, in the picture below we see an editor on embedded examples that can be edited and run independently. And this one shows how we can visualize and edit the result of querying. Just a note: To make Coder work the way we want, we extended Brick with several widgets, and enhanced significantly the linear and grid layouts. - We added the first version of xdoc in order to serialize the Playground every time you evaluate something. As always, we are looking forward to your feedback. Have fun, The feenk team -- www.feenk.com -- www.feenk.com "Every thing should have the right to be different."

6 years, 8 months

4
7
0 0

Roassal Mondrian

by Nicolas Anquetil

Several strange behavior in Roassal on a fresh moose 7.1 image (the behavior with moose 6.1). The following script tries to show classes within their packages, with color according to their numberOfLinesOfCode: |model v| model := MooseModel root allModels last. v := RTMondrian new. v shape rectangle. v nodes: (model allModelNamespaces) forEach: [ :p | v shape rectangle. v nodes: p types. v normalizer normalizeColor: #numberOfLinesOfCode using: {Color white . Color black} min: 0 max: 1000. v layout grid. ]. v layout grid. v The result is that package color changes, not class color: Now let's add the name of the packages (same script but for the 4th line): |model v| model := MooseModel root allModels last. v := RTMondrian new. v shape rectangle withTextAbove: #mooseName. v nodes: (model allModelNamespaces) forEach: [ :p | v shape rectangle. v nodes: p types. v normalizer normalizeColor: #numberOfLinesOfCode using: {Color white . Color black} min: 0 max: 1000. v layout grid. ]. v layout grid. v The result is that packages are not colored anymore but package names are : So the question is: What's wrong ? How to have package with text above in black and color of inner class depending on their numberOfLinesOfCode ? thanks nicolas -- Nicolas Anquetil RMod team -- Inria Lille

6 years, 8 months

2
1
0 0

Cannot create FAMIX models in Moose

by Andrei Chis

Hi, The current Moose build from https://ci.inria.fr/moose/job/moose-6.1 no longer works and there is the following error when creating a Famix model: - "AssertionFailure: Link to opposite links should be a bijective operation... Please check your model!" This is caused by `FAMIX.BehaviouralReference.pointed` and `FAMIX.BehaviouralReference.referer` that point to attributes in FAMIXBehaviouralEntity that are not there. They were added by Famix-CPlusPlus that is now loaded by ConfigurationOfFamix. Are there some commits missing that add the missing functionality to FAMIXBehaviouralEntity? Or should we remove for now `Famix-CPlusPlus` from ConfigurationOfFamix? Cheers, Andrei

6 years, 8 months

2
2
0 0

M2 research internship

by Jannik Laval GMail

Dear Smalltalkers, We are proposing 3 master internships about message monitoring and IoT. The development will be made in Pharo / Moose. You can find the offers on the lab's website: https://disp-lab.fr/?q=job. Internship position <https://www.disp-lab.fr/?q=content/m2-internship-monitoring-and-evaluation- exchanges-distributed-information-system> M2 Internship: Monitoring and evaluation of exchanges in a distributed information system 21 December 2018 Internship position <https://www.disp-lab.fr/?q=content/m2-internship-monitoring-application-exc hanges-iot-system> M2 Internship: Monitoring of application exchanges with an IoT system 21 December 2018 Internship position <https://www.disp-lab.fr/?q=content/m2-internship-production-dynamic-dashboa rds-monitoring-exchanges-distributed-information> M2 Internship: Production of dynamic dashboards for monitoring the exchanges of a distributed information system Please distribute to students who may be affected. Best regards -- ~~Jannik Laval~~ Enseignant-chercheur Responsable Pédagogique Licence Coordonnateur de Projet IUT Lumière, Université Lumière Lyon 2 laboratoire DISP +33 4 78 77 43 06 <http://www.jannik-laval.eu> http://www.jannik-laval.eu <http://www.phratch.com> http://www.phratch.com <http://www.approchealpes.info> http://www.approchealpes.info

6 years, 8 months

1
0
0 0

Plotting genome scale values with Roassal

by Hernán Morales Durand

Hi, I have a couple of Roassal questions regarding how to customize the plots of a genome metric known as GC skew, and how to scale the visualization to cover a (bacterial) genome scale data. I have isolated a Roassal sample code below from BioSmalltalk to show how I did an initial GC skew graphic: | b values ds | values := 'GGCTGCGTTCCCCTCAGTTAGCGCCTATCCTAAGCAGATCTGTAGTTAGTACTGTCTAAGCTTGTTAGACTACTCGGAACTTGCTGATATTAACCTTACCCCCGTCGAAACGCTTATTCCGCTTTGCTACTTCAAGCCCTGTAACATCTACTGTACTGACAAGGTTGCAGTAGCAATTGGCAAGGCTGTTTGGCATCTCAGATGACAGTTACCCGTGTTGCGCTCACCCGCAGCGACTCTCGGATACGTAACGCAGAAGACGTCTTCCGCGAGATTTGGGCGCGTCTGTCCACCTTCCCAGGTTGGCATTGGCAGAAGCTCTATCCGGCTTTGTTCCTCTAGCGGCTCCGCA' asDNASimpleSequence gcSkewInt. values := #(0 1 2 1 1 2 1 2 2 2 1 0 -1 -2 -2 -3 -3 -2 -2 -2 -2 -1 -2 -1 -2 -3 -3 -3 -3 -4 -5 -5 -5 -5 -4 -5 -5 -4 -4 -4 -5 -5 -4 -4 -4 -3 -3 -3 -3 -2 -2 -2 -3 -3 -2 -2 -3 -3 -3 -3 -2 -3 -3 -3 -2 -2 -2 -2 -1 -1 -2 -2 -2 -3 -3 -4 -3 -2 -2 -2 -3 -3 -3 -2 -3 -3 -2 -2 -2 -2 -2 -2 -2 -2 -3 -4 -4 -4 -4 -5 -6 -7 -8 -9 -8 -8 -9 -8 -8 -8 -8 -9 -8 -9 -9 -9 -9 -9 -9 -10 -11 -10 -11 -11 -11 -11 -10 -11 -11 -11 -12 -12 -12 -13 -13 -13 -12 -13 -14 -15 -15 -14 -14 -14 -14 -15 -15 -15 -16 -16 -16 -17 -17 -16 -16 -16 -17 -17 -16 -16 -17 -17 -17 -16 -15 -15 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14 -14 -14 -14 -13 -12 -13 -13 -13 -12 -11 -12 -12 -11 -11 -11 -11 -10 -9 -10 -10 -10 -11 -11 -12 -12 -11 -11 -11 -10 -10 -11 -11 -10 -10 -10 -10 -11 -12 -13 -12 -12 -11 -11 -11 -10 -11 -10 -11 -11 -12 -12 -13 -14 -15 -14 -15 -15 -14 -15 -14 -14 -15 -15 -16 -16 -17 -16 -15 -15 -15 -15 -16 -15 -15 -15 -15 -16 -15 -16 -16 -15 -15 -15 -14 -14 -15 -14 -14 -15 -15 -15 -16 -17 -16 -17 -16 -16 -15 -15 -15 -15 -15 -14 -13 -12 -13 -12 -13 -12 -12 -13 -13 -12 -12 -13 -14 -14 -15 -16 -16 -16 -17 -18 -19 -19 -18 -17 -17 -17 -16 -15 -16 -16 -16 -16 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14 -15 -15 -15 -15 -16 -17 -16 -15 -16 -16 -16 -16 -15 -15 -15 -16 -17 -17 -18 -18 -18 -17 -18 -17 -16 -17 -17 -18 -19 -18 -19 -19). b := RTGrapher new. b extent: 800 @ 500. ds := RTData new noDot; points: values; connectColor: Color red; yourself. b add: ds. b axisY minValue: values min; title: 'Skew'; color: Color black; noDecimal. b axisX numberOfTicks: 10; noDecimal; color: Color black; title: 'Position'. b open 1) You can see the result in the TR Morph.png attached file. In X axis, how can set up a tick every certain step value? For example, every 50 points. Right now this is 88, 176, 264, 353 and I would like to be 50, 100, 150, 200, 250, 300, 350, 400. 2) I just plotted a very short DNA sequence, however if I would like to plot GC skew for E.coli that would take hundreds of points. The following scripts takes ages to complete or it never ends. You will find attached the necessary files: | grapher ds eColiGCSkew zipArchive | " The original dataset " "(ZnEasy get: 'http://bioinformaticsalgorithms.com/data/realdatasets/Replication/E_coli.txt') contents asDNASimpleSequence." "'/Users/mvs/Downloads/E_coli.txt' asFileReference size." "4639675" " GC Skew calc using BioSmalltalk " "eColiGCSkew := '/Users/mvs/Downloads/E_coli.txt' asFileReference contents asDNASimpleSequence gcSkewInt." " GC Skew already calculated in a FUEL compressed for this example " zipArchive := ZipArchive new. [ zipArchive readFrom: 'ecoligcskew.zip' fullName; extractAllTo: '.' ] ensure: [ zipArchive close ]. eColiGCSkew := FLMaterializer materializeFromFileNamed: 'OrderedCollection_3712516797.obj'. grapher := RTGrapher new extent: 800 @ 500; yourself. ds := RTData new noDot; points: eColiGCSkew; connectColor: Color red; yourself. grapher add: ds. grapher axisY minValue: eColiGCSkew min; title: 'Skew'; color: Color black; noDecimal. grapher axisX numberOfTicks: 10; noDecimal; color: Color black; title: 'Position'. grapher open The skew_diagram_ecoli.png shows how the expected final plot. Cheers, Hernán

6 years, 8 months

3
7
0 0

2025

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

Moose-dev