Moose-dev

moose-dev@list.inf.unibe.ch

6621 discussions

glamorous toolkit alpha.2
by Tudor Girba 01 Nov '18

01 Nov '18

Hi, Glamorous Toolkit has evolved quite a bit over the past months, and we now would like to announce that we reached alpha.2 version. It runs on top of Pharo 7: feenk.com/gt There quite a number of new things. Some highlights are: - We added extensive documentation for GT, Bloc and Brick. By running "GtWorld openTour” you essentially transform the image into an elaborate wiki. - We worked on Coder, a new set of tools that are dedicated for affecting code. For example, in the picture below we see an editor on embedded examples that can be edited and run independently. And this one shows how we can visualize and edit the result of querying. Just a note: To make Coder work the way we want, we extended Brick with several widgets, and enhanced significantly the linear and grid layouts. - We added the first version of xdoc in order to serialize the Playground every time you evaluate something. As always, we are looking forward to your feedback. Have fun, The feenk team -- www.feenk.com -- www.feenk.com "Every thing should have the right to be different."

4 7

Roassal Mondrian
by Nicolas Anquetil 28 Oct '18

28 Oct '18

Several strange behavior in Roassal on a fresh moose 7.1 image (the behavior with moose 6.1). The following script tries to show classes within their packages, with color according to their numberOfLinesOfCode: |model v| model := MooseModel root allModels last. v := RTMondrian new. v shape rectangle. v nodes: (model allModelNamespaces) forEach: [ :p | v shape rectangle. v nodes: p types. v normalizer normalizeColor: #numberOfLinesOfCode using: {Color white . Color black} min: 0 max: 1000. v layout grid. ]. v layout grid. v The result is that package color changes, not class color: Now let's add the name of the packages (same script but for the 4th line): |model v| model := MooseModel root allModels last. v := RTMondrian new. v shape rectangle withTextAbove: #mooseName. v nodes: (model allModelNamespaces) forEach: [ :p | v shape rectangle. v nodes: p types. v normalizer normalizeColor: #numberOfLinesOfCode using: {Color white . Color black} min: 0 max: 1000. v layout grid. ]. v layout grid. v The result is that packages are not colored anymore but package names are : So the question is: What's wrong ? How to have package with text above in black and color of inner class depending on their numberOfLinesOfCode ? thanks nicolas -- Nicolas Anquetil RMod team -- Inria Lille

2 1

Cannot create FAMIX models in Moose
by Andrei Chis 18 Oct '18

18 Oct '18

Hi, The current Moose build from https://ci.inria.fr/moose/job/moose-6.1 no longer works and there is the following error when creating a Famix model: - "AssertionFailure: Link to opposite links should be a bijective operation... Please check your model!" This is caused by `FAMIX.BehaviouralReference.pointed` and `FAMIX.BehaviouralReference.referer` that point to attributes in FAMIXBehaviouralEntity that are not there. They were added by Famix-CPlusPlus that is now loaded by ConfigurationOfFamix. Are there some commits missing that add the missing functionality to FAMIXBehaviouralEntity? Or should we remove for now `Famix-CPlusPlus` from ConfigurationOfFamix? Cheers, Andrei

2 2

M2 research internship
by Jannik Laval GMail 18 Oct '18

18 Oct '18

Dear Smalltalkers, We are proposing 3 master internships about message monitoring and IoT. The development will be made in Pharo / Moose. You can find the offers on the lab's website: https://disp-lab.fr/?q=job. Internship position <https://www.disp-lab.fr/?q=content/m2-internship-monitoring-and-evaluation- exchanges-distributed-information-system> M2 Internship: Monitoring and evaluation of exchanges in a distributed information system 21 December 2018 Internship position <https://www.disp-lab.fr/?q=content/m2-internship-monitoring-application-exc hanges-iot-system> M2 Internship: Monitoring of application exchanges with an IoT system 21 December 2018 Internship position <https://www.disp-lab.fr/?q=content/m2-internship-production-dynamic-dashboa rds-monitoring-exchanges-distributed-information> M2 Internship: Production of dynamic dashboards for monitoring the exchanges of a distributed information system Please distribute to students who may be affected. Best regards -- ~~Jannik Laval~~ Enseignant-chercheur Responsable Pédagogique Licence Coordonnateur de Projet IUT Lumière, Université Lumière Lyon 2 laboratoire DISP +33 4 78 77 43 06 <http://www.jannik-laval.eu> http://www.jannik-laval.eu <http://www.phratch.com> http://www.phratch.com <http://www.approchealpes.info> http://www.approchealpes.info

1 0

Plotting genome scale values with Roassal
by Hernán Morales Durand 13 Oct '18

13 Oct '18

Hi, I have a couple of Roassal questions regarding how to customize the plots of a genome metric known as GC skew, and how to scale the visualization to cover a (bacterial) genome scale data. I have isolated a Roassal sample code below from BioSmalltalk to show how I did an initial GC skew graphic: | b values ds | values := 'GGCTGCGTTCCCCTCAGTTAGCGCCTATCCTAAGCAGATCTGTAGTTAGTACTGTCTAAGCTTGTTAGACTACTCGGAACTTGCTGATATTAACCTTACCCCCGTCGAAACGCTTATTCCGCTTTGCTACTTCAAGCCCTGTAACATCTACTGTACTGACAAGGTTGCAGTAGCAATTGGCAAGGCTGTTTGGCATCTCAGATGACAGTTACCCGTGTTGCGCTCACCCGCAGCGACTCTCGGATACGTAACGCAGAAGACGTCTTCCGCGAGATTTGGGCGCGTCTGTCCACCTTCCCAGGTTGGCATTGGCAGAAGCTCTATCCGGCTTTGTTCCTCTAGCGGCTCCGCA' asDNASimpleSequence gcSkewInt. values := #(0 1 2 1 1 2 1 2 2 2 1 0 -1 -2 -2 -3 -3 -2 -2 -2 -2 -1 -2 -1 -2 -3 -3 -3 -3 -4 -5 -5 -5 -5 -4 -5 -5 -4 -4 -4 -5 -5 -4 -4 -4 -3 -3 -3 -3 -2 -2 -2 -3 -3 -2 -2 -3 -3 -3 -3 -2 -3 -3 -3 -2 -2 -2 -2 -1 -1 -2 -2 -2 -3 -3 -4 -3 -2 -2 -2 -3 -3 -3 -2 -3 -3 -2 -2 -2 -2 -2 -2 -2 -2 -3 -4 -4 -4 -4 -5 -6 -7 -8 -9 -8 -8 -9 -8 -8 -8 -8 -9 -8 -9 -9 -9 -9 -9 -9 -10 -11 -10 -11 -11 -11 -11 -10 -11 -11 -11 -12 -12 -12 -13 -13 -13 -12 -13 -14 -15 -15 -14 -14 -14 -14 -15 -15 -15 -16 -16 -16 -17 -17 -16 -16 -16 -17 -17 -16 -16 -17 -17 -17 -16 -15 -15 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14 -14 -14 -14 -13 -12 -13 -13 -13 -12 -11 -12 -12 -11 -11 -11 -11 -10 -9 -10 -10 -10 -11 -11 -12 -12 -11 -11 -11 -10 -10 -11 -11 -10 -10 -10 -10 -11 -12 -13 -12 -12 -11 -11 -11 -10 -11 -10 -11 -11 -12 -12 -13 -14 -15 -14 -15 -15 -14 -15 -14 -14 -15 -15 -16 -16 -17 -16 -15 -15 -15 -15 -16 -15 -15 -15 -15 -16 -15 -16 -16 -15 -15 -15 -14 -14 -15 -14 -14 -15 -15 -15 -16 -17 -16 -17 -16 -16 -15 -15 -15 -15 -15 -14 -13 -12 -13 -12 -13 -12 -12 -13 -13 -12 -12 -13 -14 -14 -15 -16 -16 -16 -17 -18 -19 -19 -18 -17 -17 -17 -16 -15 -16 -16 -16 -16 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14 -15 -15 -15 -15 -16 -17 -16 -15 -16 -16 -16 -16 -15 -15 -15 -16 -17 -17 -18 -18 -18 -17 -18 -17 -16 -17 -17 -18 -19 -18 -19 -19). b := RTGrapher new. b extent: 800 @ 500. ds := RTData new noDot; points: values; connectColor: Color red; yourself. b add: ds. b axisY minValue: values min; title: 'Skew'; color: Color black; noDecimal. b axisX numberOfTicks: 10; noDecimal; color: Color black; title: 'Position'. b open 1) You can see the result in the TR Morph.png attached file. In X axis, how can set up a tick every certain step value? For example, every 50 points. Right now this is 88, 176, 264, 353 and I would like to be 50, 100, 150, 200, 250, 300, 350, 400. 2) I just plotted a very short DNA sequence, however if I would like to plot GC skew for E.coli that would take hundreds of points. The following scripts takes ages to complete or it never ends. You will find attached the necessary files: | grapher ds eColiGCSkew zipArchive | " The original dataset " "(ZnEasy get: 'http://bioinformaticsalgorithms.com/data/realdatasets/Replication/E_coli.txt') contents asDNASimpleSequence." "'/Users/mvs/Downloads/E_coli.txt' asFileReference size." "4639675" " GC Skew calc using BioSmalltalk " "eColiGCSkew := '/Users/mvs/Downloads/E_coli.txt' asFileReference contents asDNASimpleSequence gcSkewInt." " GC Skew already calculated in a FUEL compressed for this example " zipArchive := ZipArchive new. [ zipArchive readFrom: 'ecoligcskew.zip' fullName; extractAllTo: '.' ] ensure: [ zipArchive close ]. eColiGCSkew := FLMaterializer materializeFromFileNamed: 'OrderedCollection_3712516797.obj'. grapher := RTGrapher new extent: 800 @ 500; yourself. ds := RTData new noDot; points: eColiGCSkew; connectColor: Color red; yourself. grapher add: ds. grapher axisY minValue: eColiGCSkew min; title: 'Skew'; color: Color black; noDecimal. grapher axisX numberOfTicks: 10; noDecimal; color: Color black; title: 'Position'. grapher open The skew_diagram_ecoli.png shows how the expected final plot. Cheers, Hernán

3 7

Looking for Job Opportunities
by Vincent BLONDEAU 09 Oct '18

09 Oct '18

Dear Smalltalk community, My current contract at Lam Research is ending soon, I am looking for job opportunities starting in January 2019. Last year, I finished my Ph.D. in Testing and Software Quality in the Inria's Rmod team in France. I have been working with Pharo for five years and Visual Works for one year. I am also experienced in creating tools to improve the efficiency of the developers. Here are my website: https://vincentblondeau.github.io/ my LinkedIn: https://www.linkedin.com/in/vincent-blondeau/ and my GitHub: https://github.com/VincentBlondeau/ You can find my resume as an attachment. I look forward to hearing from you. Best Regards, Vincent Blondeau

2 1

Re: [Pharo-users] Pharo eye-candy: Domain-Specific Modeling and Simulation
by Nick Papoylias 07 Sep '18

07 Sep '18

Thanx Alex :) Looking forward to the Roassal talk on Thursday ! On Fri, Sep 7, 2018 at 5:22 PM Alexandre Bergel via Pharo-users < pharo-users(a)lists.pharo.org> wrote: > Wow!!!!! > You guys rock! > > Alexandre > -- > _,.;:~^~:;._,.;:~^~:;._,.;:~^~:;._,.;:~^~:;._,.;: > Alexandre Bergel http://www.bergel.eu > ^~:;._,.;:~^~:;._,.;:~^~:;._,.;:~^~:;._,.;:~^~:;. > > > > On Sep 6, 2018, at 2:17 PM, Nick Papoylias <npapoylias(a)gmail.com> wrote: > > A nice example of how Pharo can be used for > domain-specific modeling and simulation. Short > session from one of our projects at Rochelle: > > https://www.youtube.com/watch?v=Z7wJNhAIaVQ > > Some additional info here: https://goo.gl/jS4NjB > > Currently investigating how to incorporate the new Bloc based > widgets of @feenkcom into the workflow. > > Cheers, > > Nick > _______________________________________________ > Moose-dev mailing list > Moose-dev(a)list.inf.unibe.ch > https://www.list.inf.unibe.ch/listinfo/moose-dev > > >

1 0

Pharo eye-candy: Domain-Specific Modeling and Simulation
by Nick Papoylias 07 Sep '18

07 Sep '18

A nice example of how Pharo can be used for domain-specific modeling and simulation. Short session from one of our projects at Rochelle: https://www.youtube.com/watch?v=Z7wJNhAIaVQ Some additional info here: https://goo.gl/jS4NjB Currently investigating how to incorporate the new Bloc based widgets of @feenkcom into the workflow. Cheers, Nick

5 8

Centering edges over composites
by Hernán Morales Durand 06 Sep '18

06 Sep '18

Hi, When connecting two composite shapes with RTEdgeBuilder, the connector position loose its center over the connecting shapes. It's easier to explain with two scripts: This one looks good, the connector (RTArrowedLine) is centered: | view shapes myElems | view := RTView new. myElems := 1 to: 2. shapes := (RTSVGPath new path: 'm 3.96875,9.2604167 h 31.75 V 25.135417 C 22.489583,23.8125 17.197917,34.395833 3.96875,27.78125 Z'; fillColor: Color red; borderColor: Color black; borderWidth: 1.2; scale: 1.4) elementsOn: myElems. view addAll: shapes. RTEdgeBuilder new view: view; shape: (RTArrowedLine new color: Color white; yourself); elements: shapes; connectFrom: 1 to: 2. RTTreeLayout new verticalGap: 30; horizontalGap: 30; applyOn: shapes. view inspect. However when adding a label in a composite, both label and arrow looks shifted: | view shape shapes myElems | view := RTView new. myElems := 1 to: 2. shape := RTCompositeShape new add: (RTLabel new text: 'Test'); add: (RTSVGPath new path: 'm 3.96875,9.2604167 h 31.75 V 25.135417 C 22.489583,23.8125 17.197917,34.395833 3.96875,27.78125 Z'; fillColor: Color red; borderColor: Color black; borderWidth: 1.2; scale: 1.4); vertical; yourself. shapes := shape elementsOn: myElems. view addAll: shapes. RTEdgeBuilder new view: view; shape: (RTArrowedLine new color: Color white; yourself); elements: shapes; connectFrom: 1 to: 2. RTTreeLayout new verticalGap: 30; horizontalGap: 30; applyOn: shapes. view inspect. Any idea how to align these shapes? Cheers, Hernán

3 8

feenk log
by Tudor Girba 17 Aug '18

17 Aug '18

Hi, We again got carried away and forgot to update the world about what is up in our corner. Here is a summary: -- Bloc & Brick -- - Text editor stability has been significantly improved - Improved support for selection in the text editor - Support for typical editing keybindings (copy, cut, paste) - Text editor debuggability: https://twitter.com/feenkcom/status/1024680215379959808 https://twitter.com/feenkcom/status/1020768298017992704 - The text editor can handle emojis: https://twitter.com/feenkcom/status/1021872214151507968 -- GT -- - Inspector We now have an initial version of a working inspector with resizable panes: https://twitter.com/feenkcom/status/1030091849795612672 https://twitter.com/feenkcom/status/1030314856736538624 It shows a display string for the current object: https://twitter.com/feenkcom/status/1024564065870512129 It can handle errors in the definition of views gracefully: https://twitter.com/feenkcom/status/1009174937217720320 We now have multiple extensions expressed in the new Inspector: https://twitter.com/feenkcom/status/1024321868566814720 https://twitter.com/feenkcom/status/1022393383850008576 - Documenter saw multiple enhancements. We can now resize various previews live: https://twitter.com/feenkcom/status/1002851190475026432 https://twitter.com/feenkcom/status/1001407762285375490 https://twitter.com/feenkcom/status/1001152789874167808 It now relies on the annotation mechanism from Pillar: https://twitter.com/feenkcom/status/1006508725409079298 We can now link classes and expand their definition: https://twitter.com/feenkcom/status/1014609460520775681 https://twitter.com/feenkcom/status/1029085603948843008 The preview of examples can handle errors gracefully: https://twitter.com/feenkcom/status/1022123808524836864 We can run examples in place, enabling a smoother tutorial experience: https://twitter.com/feenkcom/status/1028390957023223809 We have new documentation expressed in it: https://twitter.com/feenkcom/status/1007008814204444672 Have fun, The feenk team -- www.feenk.com "Presenting is storytelling."

4 4

← Newer
1
...
5
6
7
8
9
10
11
...
663
Older →

Jump to page:

2025

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

Moose-dev