Moose-dev September 2018

moose-dev@list.inf.unibe.ch

5 participants
5 discussions

Fwd: [Pharo-users] [ ANN ] Pharo Days 2016
by Tudor Girba 08 Mar '24

08 Mar '24

> Begin forwarded message: > > From: Sven Van Caekenberghe <sven(a)stfx.eu> > Subject: [Pharo-users] [ ANN ] Pharo Days 2016 > Date: December 9, 2015 at 9:52:09 AM EST > To: Any question about pharo is welcome <pharo-users(a)lists.pharo.org>, Pharo Development List <pharo-dev(a)lists.pharo.org>, Pharo Business <pharo-business(a)lists.pharo.org> > Reply-To: Any question about pharo is welcome <pharo-users(a)lists.pharo.org> > > Dear fellow Pharoers, > > Mark your calendars: on Thursday March 31 & Friday April 1 we are organising the Pharo Days 2016. This year we moved the location to Namur, Belgium, just a bit south of Brussels, at the very beautiful location of the ‘Cercle de Wallonie’ overlooking the river Meuse. > > We’ll update the following page moving forward. > > https://medium.com/concerning-pharo/pharo-days-2016-c52fe4d7caf > > You can ask questions on any of the Pharo mailing lists or you can email the Pharo Board. > > Let's make this another success, together ! We hope to see as many of you as possible. > > -- www.tudorgirba.com "We are all great at making mistakes."

4 3

Plotting genome scale values with Roassal
by Hernán Morales Durand 13 Oct '18

13 Oct '18

Hi, I have a couple of Roassal questions regarding how to customize the plots of a genome metric known as GC skew, and how to scale the visualization to cover a (bacterial) genome scale data. I have isolated a Roassal sample code below from BioSmalltalk to show how I did an initial GC skew graphic: | b values ds | values := 'GGCTGCGTTCCCCTCAGTTAGCGCCTATCCTAAGCAGATCTGTAGTTAGTACTGTCTAAGCTTGTTAGACTACTCGGAACTTGCTGATATTAACCTTACCCCCGTCGAAACGCTTATTCCGCTTTGCTACTTCAAGCCCTGTAACATCTACTGTACTGACAAGGTTGCAGTAGCAATTGGCAAGGCTGTTTGGCATCTCAGATGACAGTTACCCGTGTTGCGCTCACCCGCAGCGACTCTCGGATACGTAACGCAGAAGACGTCTTCCGCGAGATTTGGGCGCGTCTGTCCACCTTCCCAGGTTGGCATTGGCAGAAGCTCTATCCGGCTTTGTTCCTCTAGCGGCTCCGCA' asDNASimpleSequence gcSkewInt. values := #(0 1 2 1 1 2 1 2 2 2 1 0 -1 -2 -2 -3 -3 -2 -2 -2 -2 -1 -2 -1 -2 -3 -3 -3 -3 -4 -5 -5 -5 -5 -4 -5 -5 -4 -4 -4 -5 -5 -4 -4 -4 -3 -3 -3 -3 -2 -2 -2 -3 -3 -2 -2 -3 -3 -3 -3 -2 -3 -3 -3 -2 -2 -2 -2 -1 -1 -2 -2 -2 -3 -3 -4 -3 -2 -2 -2 -3 -3 -3 -2 -3 -3 -2 -2 -2 -2 -2 -2 -2 -2 -3 -4 -4 -4 -4 -5 -6 -7 -8 -9 -8 -8 -9 -8 -8 -8 -8 -9 -8 -9 -9 -9 -9 -9 -9 -10 -11 -10 -11 -11 -11 -11 -10 -11 -11 -11 -12 -12 -12 -13 -13 -13 -12 -13 -14 -15 -15 -14 -14 -14 -14 -15 -15 -15 -16 -16 -16 -17 -17 -16 -16 -16 -17 -17 -16 -16 -17 -17 -17 -16 -15 -15 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14 -14 -14 -14 -13 -12 -13 -13 -13 -12 -11 -12 -12 -11 -11 -11 -11 -10 -9 -10 -10 -10 -11 -11 -12 -12 -11 -11 -11 -10 -10 -11 -11 -10 -10 -10 -10 -11 -12 -13 -12 -12 -11 -11 -11 -10 -11 -10 -11 -11 -12 -12 -13 -14 -15 -14 -15 -15 -14 -15 -14 -14 -15 -15 -16 -16 -17 -16 -15 -15 -15 -15 -16 -15 -15 -15 -15 -16 -15 -16 -16 -15 -15 -15 -14 -14 -15 -14 -14 -15 -15 -15 -16 -17 -16 -17 -16 -16 -15 -15 -15 -15 -15 -14 -13 -12 -13 -12 -13 -12 -12 -13 -13 -12 -12 -13 -14 -14 -15 -16 -16 -16 -17 -18 -19 -19 -18 -17 -17 -17 -16 -15 -16 -16 -16 -16 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14 -15 -15 -15 -15 -16 -17 -16 -15 -16 -16 -16 -16 -15 -15 -15 -16 -17 -17 -18 -18 -18 -17 -18 -17 -16 -17 -17 -18 -19 -18 -19 -19). b := RTGrapher new. b extent: 800 @ 500. ds := RTData new noDot; points: values; connectColor: Color red; yourself. b add: ds. b axisY minValue: values min; title: 'Skew'; color: Color black; noDecimal. b axisX numberOfTicks: 10; noDecimal; color: Color black; title: 'Position'. b open 1) You can see the result in the TR Morph.png attached file. In X axis, how can set up a tick every certain step value? For example, every 50 points. Right now this is 88, 176, 264, 353 and I would like to be 50, 100, 150, 200, 250, 300, 350, 400. 2) I just plotted a very short DNA sequence, however if I would like to plot GC skew for E.coli that would take hundreds of points. The following scripts takes ages to complete or it never ends. You will find attached the necessary files: | grapher ds eColiGCSkew zipArchive | " The original dataset " "(ZnEasy get: 'http://bioinformaticsalgorithms.com/data/realdatasets/Replication/E_coli.txt') contents asDNASimpleSequence." "'/Users/mvs/Downloads/E_coli.txt' asFileReference size." "4639675" " GC Skew calc using BioSmalltalk " "eColiGCSkew := '/Users/mvs/Downloads/E_coli.txt' asFileReference contents asDNASimpleSequence gcSkewInt." " GC Skew already calculated in a FUEL compressed for this example " zipArchive := ZipArchive new. [ zipArchive readFrom: 'ecoligcskew.zip' fullName; extractAllTo: '.' ] ensure: [ zipArchive close ]. eColiGCSkew := FLMaterializer materializeFromFileNamed: 'OrderedCollection_3712516797.obj'. grapher := RTGrapher new extent: 800 @ 500; yourself. ds := RTData new noDot; points: eColiGCSkew; connectColor: Color red; yourself. grapher add: ds. grapher axisY minValue: eColiGCSkew min; title: 'Skew'; color: Color black; noDecimal. grapher axisX numberOfTicks: 10; noDecimal; color: Color black; title: 'Position'. grapher open The skew_diagram_ecoli.png shows how the expected final plot. Cheers, Hernán

3 7

Re: [Pharo-users] Pharo eye-candy: Domain-Specific Modeling and Simulation
by Nick Papoylias 07 Sep '18

07 Sep '18

Thanx Alex :) Looking forward to the Roassal talk on Thursday ! On Fri, Sep 7, 2018 at 5:22 PM Alexandre Bergel via Pharo-users < pharo-users(a)lists.pharo.org> wrote: > Wow!!!!! > You guys rock! > > Alexandre > -- > _,.;:~^~:;._,.;:~^~:;._,.;:~^~:;._,.;:~^~:;._,.;: > Alexandre Bergel http://www.bergel.eu > ^~:;._,.;:~^~:;._,.;:~^~:;._,.;:~^~:;._,.;:~^~:;. > > > > On Sep 6, 2018, at 2:17 PM, Nick Papoylias <npapoylias(a)gmail.com> wrote: > > A nice example of how Pharo can be used for > domain-specific modeling and simulation. Short > session from one of our projects at Rochelle: > > https://www.youtube.com/watch?v=Z7wJNhAIaVQ > > Some additional info here: https://goo.gl/jS4NjB > > Currently investigating how to incorporate the new Bloc based > widgets of @feenkcom into the workflow. > > Cheers, > > Nick > _______________________________________________ > Moose-dev mailing list > Moose-dev(a)list.inf.unibe.ch > https://www.list.inf.unibe.ch/listinfo/moose-dev > > >

1 0

Pharo eye-candy: Domain-Specific Modeling and Simulation
by Nick Papoylias 07 Sep '18

07 Sep '18

A nice example of how Pharo can be used for domain-specific modeling and simulation. Short session from one of our projects at Rochelle: https://www.youtube.com/watch?v=Z7wJNhAIaVQ Some additional info here: https://goo.gl/jS4NjB Currently investigating how to incorporate the new Bloc based widgets of @feenkcom into the workflow. Cheers, Nick

5 8

Centering edges over composites
by Hernán Morales Durand 06 Sep '18

06 Sep '18

Hi, When connecting two composite shapes with RTEdgeBuilder, the connector position loose its center over the connecting shapes. It's easier to explain with two scripts: This one looks good, the connector (RTArrowedLine) is centered: | view shapes myElems | view := RTView new. myElems := 1 to: 2. shapes := (RTSVGPath new path: 'm 3.96875,9.2604167 h 31.75 V 25.135417 C 22.489583,23.8125 17.197917,34.395833 3.96875,27.78125 Z'; fillColor: Color red; borderColor: Color black; borderWidth: 1.2; scale: 1.4) elementsOn: myElems. view addAll: shapes. RTEdgeBuilder new view: view; shape: (RTArrowedLine new color: Color white; yourself); elements: shapes; connectFrom: 1 to: 2. RTTreeLayout new verticalGap: 30; horizontalGap: 30; applyOn: shapes. view inspect. However when adding a label in a composite, both label and arrow looks shifted: | view shape shapes myElems | view := RTView new. myElems := 1 to: 2. shape := RTCompositeShape new add: (RTLabel new text: 'Test'); add: (RTSVGPath new path: 'm 3.96875,9.2604167 h 31.75 V 25.135417 C 22.489583,23.8125 17.197917,34.395833 3.96875,27.78125 Z'; fillColor: Color red; borderColor: Color black; borderWidth: 1.2; scale: 1.4); vertical; yourself. shapes := shape elementsOn: myElems. view addAll: shapes. RTEdgeBuilder new view: view; shape: (RTArrowedLine new color: Color white; yourself); elements: shapes; connectFrom: 1 to: 2. RTTreeLayout new verticalGap: 30; horizontalGap: 30; applyOn: shapes. view inspect. Any idea how to align these shapes? Cheers, Hernán

3 8

2025

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

Moose-dev September 2018